FastQCFastQC Report
Tue 8 Mar 2016
small_rna.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filenamesmall_rna.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences250000
Sequences flagged as poor quality0
Sequence length100
%GC45

[WARN]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGAGGTAGTAGATTGTATAGTTAGATCGGAAGAGCACACGTCTGAACTCC108654.346Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TAGCTTATCAGACTGATGTTGACAGATCGGAAGAGCACACGTCTGAACTC108454.338Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGAGATCGGAAGAGCACACGTCTGAACTCC70622.8247999999999998Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGAAGATCGGAAGAGCACACGTCTGAACTC40561.6223999999999998Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TGAGGTAGTAGTTTGTGCTGTTAGATCGGAAGAGCACACGTCTGAACTCC37371.4948Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TGAGGTAGTAGTTTGTACAGTTAGATCGGAAGAGCACACGTCTGAACTCC35491.4196Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TGAGGTAGTAGGTTGTATGGTTAGATCGGAAGAGCACACGTCTGAACTCC29311.1724Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
AACCCGTAGATCCGATCTTGTAGATCGGAAGAGCACACGTCTGAACTCCA19100.764Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)
CGCGACCTCAGATCAGACGTAGATCGGAAGAGCACACGTCTGAACTCCAG17490.6996Illumina Multiplexing PCR Primer 2.01 (100% over 30bp)
TGAGGTAGTAGGTTGTATAGTTAGATCGGAAGAGCACACGTCTGAACTCC16470.6588Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATAGATCGGAAGAGCACACGTCTGAACTCCA16220.6487999999999999Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)
TAGCTTATCAGACTGATGTTGATAGATCGGAAGAGCACACGTCTGAACTC13280.5312Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTAGATCGGAAGAGCACACGTCTGAACTCC12480.4992Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
AGCAGCATTGTACAGGGCTATGAAGATCGGAAGAGCACACGTCTGAACTC12480.4992Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TGAGGTAGTAGATTGTATAGTCAGATCGGAAGAGCACACGTCTGAACTCC11500.45999999999999996Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TGTAAACATCCCCGACTGGAAGCTAGATCGGAAGAGCACACGTCTGAACT11100.44400000000000006Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
TAGCTTATCAGACTGATGTTGACTAGATCGGAAGAGCACACGTCTGAACT10800.432Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
TGAGGTAGTAGATTGTATAGTAGATCGGAAGAGCACACGTCTGAACTCCA10130.4052Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGTAGATCGGAAGAGCACACGTCTGAACTC9380.37520000000000003Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TAGCTTATCAGACTGATGTTGACAAGATCGGAAGAGCACACGTCTGAACT7870.3148Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
TGGAAGACTAGTGATTTTGTTGTTAGATCGGAAGAGCACACGTCTGAACT7820.3128Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
TAGCTTATCAGACTGATGTTGAAGATCGGAAGAGCACACGTCTGAACTCC7500.3Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
CGCGACCTCAGATCAGACGAGATCGGAAGAGCACACGTCTGAACTCCAGT7140.2856Illumina Multiplexing PCR Primer 2.01 (100% over 31bp)
GGCTGGTCCGAAGGTAGTGAGTTATCTCAATAGATCGGAAGAGCACACGT7060.2824No Hit
TGAGGTAGTAGGTTGTGTGGTTAGATCGGAAGAGCACACGTCTGAACTCC7040.2816Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
CACCCGTAGAACCGACCTTGCGAGATCGGAAGAGCACACGTCTGAACTCC6710.2684Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
CGCGACCTCAGATCAGACGTGGAGATCGGAAGAGCACACGTCTGAACTCC6430.2572Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCAGATCGGAAGAGCACACGTCTGAACTCCA6010.2404Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)
GACTCTTAGCGGTGGATCACTCGGCAGATCGGAAGAGCACACGTCTGAAC5990.2396Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
AGAATTGTGGCTGGACATCTGTAGATCGGAAGAGCACACGTCTGAACTCC5960.23839999999999997Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTAGATCGGAAGAGCACACGTCTGAACTCC5720.2288Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
CGACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC5580.2232No Hit
AACATTCAACGCTGTCGGTGAGTAGATCGGAAGAGCACACGTCTGAACTC5440.2176Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATAAGATCGGAAGAGCACACGTCTGAACTCC5390.21559999999999999Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
ACCGGGTGCTGTAGGCTTTAGATCGGAAGAGCACACGTCTGAACTCCAGT5270.21080000000000002Illumina Multiplexing PCR Primer 2.01 (100% over 31bp)
TGTAAACATCCTCGACTGGAAGCTAGATCGGAAGAGCACACGTCTGAACT5150.20600000000000002Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
AGAAGACGGTCGAACTTGACTATCTAGATCGGAAGAGCACACGTCTGAAC5010.20040000000000002Illumina Multiplexing PCR Primer 2.01 (100% over 25bp)
AACCCGTAGATCCGATCTTGTGAGATCGGAAGAGCACACGTCTGAACTCC4850.194Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCAGATCGGAAGAGCACACGT4700.188No Hit
AGAGGTAGTAGGTTGCATAGTTAGATCGGAAGAGCACACGTCTGAACTCC4540.18159999999999998Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
GACTCTTAGCGGTGGATCACTCGGCTAGATCGGAAGAGCACACGTCTGAA4500.18Illumina Multiplexing PCR Primer 2.01 (100% over 24bp)
TAAAGTGCTTATAGTGCAGGTAGAGATCGGAAGAGCACACGTCTGAACTC4500.18Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
AACCCGTAGATCCGATCTTGTGAAGATCGGAAGAGCACACGTCTGAACTC4470.17880000000000001Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TGAGGTAGTAGTTTGTGCTGTAGATCGGAAGAGCACACGTCTGAACTCCA4300.172Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)
CTTCTCACTACTGCACTTGACTAGTCTTAGATCGGAAGAGCACACGTCTG4220.1688Illumina Multiplexing PCR Primer 2.01 (100% over 22bp)
TGAGGTAGTAGTTTGTGCTGTTAAGATCGGAAGAGCACACGTCTGAACTC3920.1568Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
AAGACGGTCGAACTTGACTATCTAGATCGGAAGAGCACACGTCTGAACTC3890.15560000000000002Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
CGCGACCTCAGATCAGAAGATCGGAAGAGCACACGTCTGAACTCCAGTCA3870.1548Illumina Multiplexing PCR Primer 2.01 (100% over 33bp)
TGAGGTAGTAGTTTGTGCTGTCAGATCGGAAGAGCACACGTCTGAACTCC3750.15Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TGAGGTAGTAGTTTGTACAGTCAGATCGGAAGAGCACACGTCTGAACTCC3690.1476Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TTATAAAGCAATGAGACTGATTAGATCGGAAGAGCACACGTCTGAACTCC3620.1448Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTAGATCGGAAGAGCACACG3570.1428No Hit
AAGCTGCCAGTTGAAGAACTGTAGATCGGAAGAGCACACGTCTGAACTCC3520.1408Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTAGATCGGAAGAGCACAC3510.1404No Hit
ACTGGACTTGGAGTCAGAAGGCAGATCGGAAGAGCACACGTCTGAACTCC3390.1356Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TGAGGTAGTAGGTTGTATGGTCAGATCGGAAGAGCACACGTCTGAACTCC3360.1344Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
GAGAAGACGGTCGAACTTGACTATCTAGATCGGAAGAGCACACGTCTGAA3200.128Illumina Multiplexing PCR Primer 2.01 (100% over 24bp)
CGCGACCTCAGATCAGACAGATCGGAAGAGCACACGTCTGAACTCCAGTC3140.1256Illumina Multiplexing PCR Primer 2.01 (100% over 32bp)
TGAGGTAGTAGTTTGTACAGTAGATCGGAAGAGCACACGTCTGAACTCCA3110.12440000000000001Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)
TGCACTGATGAAACTAGAAATAGGAAGTGCCGTCCGAAACGACAACTGAC3070.12279999999999999No Hit
GACTCTTAGCGGTGGATCACTCGGCTCAGATCGGAAGAGCACACGTCTGA3010.1204Illumina Multiplexing PCR Primer 2.01 (100% over 23bp)
TAGCTTATCAGACTGATGTTGAGATCGGAAGAGCACACGTCTGAACTCCA2960.11839999999999999Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTAGATCGGAAGAGCACACG2950.11800000000000001No Hit
TGTAAACATCCCCGACTGGAAGCAGATCGGAAGAGCACACGTCTGAACTC2880.1152Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TAGCTTATCAGACTGATGTTGACCAGATCGGAAGAGCACACGTCTGAACT2770.11080000000000001Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
TGAGGTAGTAGTTTGTGCTGTTTAGATCGGAAGAGCACACGTCTGAACTC2760.1104Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
TCAGTGCACTACAGAACTTTGTAGATCGGAAGAGCACACGTCTGAACTCC2680.1072Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGCTGTGATCTCGTA2670.10679999999999999TruSeq Adapter, Index 10 (97% over 38bp)
CTAGACTGAGGCTCCTTGAGGAGATCGGAAGAGCACACGTCTGAACTCCA2640.10560000000000001Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGATAGATCGGAAGAGCACACGTCTGAACT2640.10560000000000001Illumina Multiplexing PCR Primer 2.01 (100% over 26bp)
CATGCCTTGAGTGTAGGACTGTAGATCGGAAGAGCACACGTCTGAACTCC2640.10560000000000001Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
CGACTCTTAGCGGTGGATCACTCGGCTCGTGAGATCGGAAGAGCACACGT2610.1044No Hit
TGAGAAGACGGTCGAACTTGACTATCTAGATCGGAAGAGCACACGTCTGA2610.1044Illumina Multiplexing PCR Primer 2.01 (100% over 23bp)
AACATTCAACGCTGTCGGTGAGAGATCGGAAGAGCACACGTCTGAACTCC2580.10319999999999999Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TGAGGTAGTAGATTGTATAGTTAAGATCGGAAGAGCACACGTCTGAACTC2520.1008Illumina Multiplexing PCR Primer 2.01 (100% over 27bp)
CTTTGGTTATCTAGCTGTATGAAGATCGGAAGAGCACACGTCTGAACTCC2520.1008Illumina Multiplexing PCR Primer 2.01 (100% over 28bp)
TGAGGTAGTAGGTTGTATGGTAGATCGGAAGAGCACACGTCTGAACTCCA2520.1008Illumina Multiplexing PCR Primer 2.01 (100% over 29bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACCTGG254.8805487E-794.094521
CAACGGA500.094.094521
TTCAAGT2700.094.094511
ACCATCG156.8683457E-494.094511
TAGCTTA19550.094.094511
GGCTGGT1650.094.094511
AAGGGAT201.8259354E-594.094511
CACCCGT1200.094.094511
ATTGCGA156.8683457E-494.094511
TGAGGTG301.31240085E-894.094511
ATCACAT156.8683457E-494.094511
GTGGTGT409.094947E-1294.094511
ACTGGAC650.094.094511
TAAAGTG800.094.094511
AAGCTGC450.094.094511
TGCGGAA156.8683457E-494.094511
TGTAAAC3100.094.094511
CTTTTTG301.31240085E-894.094511
GTAAACA3100.094.0004042
ATGGGTG700.094.00043