FastQCFastQC Report
Tue 8 Mar 2016
bad_sequence.txt

Summary

[OK]Basic Statistics

MeasureValue
Filenamebad_sequence.txt
File typeConventional base calls
EncodingIllumina 1.5
Total Sequences395288
Sequences flagged as poor quality0
Sequence length40
%GC47

[FAIL]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTC20650.5224039181558763No Hit
GATTGGCGTATCCAACCTGCAGAGTTTTATCGCTTCCATG20470.5178502762542754No Hit
ATTGGCGTATCCAACCTGCAGAGTTTTATCGCTTCCATGA20140.5095019327680071No Hit
CGATAAAAATGATTGGCGTATCCAACCTGCAGAGTTTTAT19130.4839509420979134No Hit
GTATCCAACCTGCAGAGTTTTATCGCTTCCATGACGCAGA18790.47534961850600066No Hit
AAAAATGATTGGCGTATCCAACCTGCAGAGTTTTATCGCT18460.4670012750197325No Hit
TGATTGGCGTATCCAACCTGCAGAGTTTTATCGCTTCCAT18410.46573637449150995No Hit
AACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTAA18360.46447147396328753No Hit
GATAAAAATGATTGGCGTATCCAACCTGCAGAGTTTTATC18310.4632065734350651No Hit
AAATGATTGGCGTATCCAACCTGCAGAGTTTTATCGCTTC17790.45005160794155147No Hit
ATGATTGGCGTATCCAACCTGCAGAGTTTTATCGCTTCCA17790.45005160794155147No Hit
AATGATTGGCGTATCCAACCTGCAGAGTTTTATCGCTTCC17600.4452449859343061No Hit
AAAATGATTGGCGTATCCAACCTGCAGAGTTTTATCGCTT17290.4374026026593269No Hit
CGTATCCAACCTGCAGAGTTTTATCGCTTCCATGACGCAG17130.43335492096901496No Hit
ATCCAACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAG17080.43209002044079253No Hit
CAGAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTT16840.42601849790532476No Hit
TGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTAACACT16680.4219708162150128No Hit
CAACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTA16680.4219708162150128No Hit
TATCCAACCTGCAGAGTTTTATCGCTTCCATGACGCAGAA16300.4123575722005221No Hit
GTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAA16200.40982777114407726No Hit
AACTTCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGG16160.4088158507214993No Hit
GCAGAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTT15800.39970856691829754No Hit
TGGCGTATCCAACCTGCAGAGTTTTATCGCTTCCATGACG15690.3969257857562082No Hit
GGCGTATCCAACCTGCAGAGTTTTATCGCTTCCATGACGC15420.39009532290380683No Hit
ATAAAAATGATTGGCGTATCCAACCTGCAGAGTTTTATCG14810.37466353645949285No Hit
ACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTAAC14790.37415757624820384No Hit
ATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCA14520.3673271133958026No Hit
GATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATC14200.35923175001517876No Hit
CGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCA14120.3572079091700229No Hit
ACTTCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGA13680.34607678452166524No Hit
TAACTTCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTG13630.34481188399344276No Hit
CATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATC13330.337222480824108No Hit
CGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTAT13040.32988605776041774No Hit
TAAAAATGATTGGCGTATCCAACCTGCAGAGTTTTATCGC12770.32305559490801644No Hit
GCGTATCCAACCTGCAGAGTTTTATCGCTTCCATGACGCA12620.31926089332334906No Hit
TGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGC12330.3119244702596588No Hit
GGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATT11820.2990224848717897No Hit
AAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTT11360.2873854000121431No Hit
ACTCTGCAGGTTGGATACGCCAATCATTTTTATCGAAGCG11330.28662645969520956No Hit
AAACTCTGCAGGTTGGATACGCCAATCATTTTTATCGAAG11310.2861204994839206No Hit
AAAACTCTGCAGGTTGGATACGCCAATCATTTTTATCGAA11290.2856145392726316No Hit
AGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTT11130.2815668575823197No Hit
ATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATCG11110.28106089737103074No Hit
AACTCTGCAGGTTGGATACGCCAATCATTTTTATCGAAGC10830.273977454412985No Hit
CTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTAACAC10550.2668940114549392No Hit
TTCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATA9470.23957216004533402No Hit
TGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCAT9460.23931917993968954No Hit
TAAAACTCTGCAGGTTGGATACGCCAATCATTTTTATCGA9120.2307178563477768No Hit
GAAGCGATAAAACTCTGCAGGTTGGATACGCCAATCATTT8880.224646333812309No Hit
GCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCC8050.20364898504381615No Hit
GCGATAAAACTCTGCAGGTTGGATACGCCAATCATTTTTA7850.19858938293092632No Hit
TTGGCGTATCCAACCTGCAGAGTTTTATCGCTTCCATGAC7840.1983364028252818No Hit
CTTCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGAT7620.192770840501103No Hit
TCCAACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGT7520.19024103944465806No Hit
CCAACCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTT7440.18821719859950212No Hit
TCATGGAAGCGATAAAACTCTGCAGGTTGGATACGCCAAT6650.16823177025358726No Hit
TCTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATAC6270.15861852623909656No Hit
CCTGCAGAGTTTTATCGCTTCCATGACGCAGAAGTTAACA6130.15507680476007366No Hit
CGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGC5990.15153508328105078Illumina Paired End PCR Primer 2 (96% over 25bp)
TCTGCAGGTTGGATACGCCAATCATTTTTATCGAAGCGCG5850.1479933618020279No Hit
CGCTTAAAGCTACCAGTTATATGGCTGGGGGGTTTTTTTT5520.13964501831575965No Hit
CTCTGCAGGTTGGATACGCCAATCATTTTTATCGAAGCGC5320.1345854162028698No Hit
CTGCGTCATGGAAGCGATAAAACTCTGCAGGTTGGATACG5150.13028475440691342No Hit
CTGCAGGTTGGATACGCCAATCATTTTTATCGAAGCGCGC5050.12775495335046852No Hit
GCTTAAAGCTACCAGTTATATGGCTGGGGGGTTTTTTTTG4110.10397482341988626No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGGTCC301.5992917E-533.621134
CGAGACC1050.032.3797529
CCGAGTG900.031.80303228
GCCGAGT1700.031.62507827
GAGACCG950.030.82631530
CCGAGTC304.3762376E-429.81534428
CCGAGAC1400.029.3894128
TTATAGG403.5934427E-629.176231
GGAATGC5900.026.7789622
AGGAATG6150.026.49371521
GCACGGA458.934323E-625.95083612
CGCTTAA3000.025.58661
ATGCCGA6300.025.31334925
TGCCGAG6250.025.23259426
ACCACAT401.2137111E-424.97652816
AATGCCG6500.024.80338924
GAATGCC6350.024.63764823
CACTTTC3250.024.31064434
CAGGAAT6700.024.29835720
GCGGTTC6900.023.93905811