FastQCFastQC Report
Tue 8 Mar 2016
RRBS.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
FilenameRRBS.fastq.gz
File typeConventional base calls
EncodingIllumina 1.5
Total Sequences100000
Sequences flagged as poor quality0
Sequence length40
%GC36

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CGGGGTTTAGTAAATATAGAAGTGGATGTTTATAGTTAGT27322.732No Hit
CGGGGTATTGGTTAGTTTATAATGTTGTTTTATTTATAGG7490.749No Hit
CGGGATTCGTCGAATTTAGGAAATTAGTTTGAATAGGTGA4670.46699999999999997No Hit
CGGGTTATTTTGTTAGTAGAGTTTTGTTTAATATTCGTAA4220.422No Hit
CGGGGTTTAGTAAATATAGAAGTGGATGATTATAGTTAGT3790.379No Hit
CGGTATTGTAGAATAGTGTATATTAATGAGTTATAATGAA3160.316No Hit
CGGTTGAATATTTATTTGAGGTATTAATAGGAAGTCGGAG2490.249No Hit
CGGTTTGTTAGGATTTAGGAAGTAGTTAGAGAGGCGATTT2370.23700000000000002No Hit
CGGGTAGTTTGTTTTTTTATGTATCGTAGTTTTAAGTTTC2330.233No Hit
CGGATAGTTTTTGGGACGGGTAGAAGTATAGAGTCGTTGA2100.21No Hit
CGGAATTAAGATGGCGATCGTTGTTGTTGAGGTTGAGGTC1940.194No Hit
CGGGGTATTGGTTAGTTTATAATGTTGATTTATTTATAGG1800.18No Hit
CGGGTTTGATTTGGGGTATAAGTTTTTTTCGTTCGATTCG1790.179No Hit
CGGATTAGAGGATAGGTGTTCGTTTGGTTTGGGAGGCGGT1490.149No Hit
CGGTTGTTTGCGGTTCGTTTAGGTTGTTGTTTTAGCGGTT1450.145No Hit
CGGGAGTGGGAGTATATAAGGTATGAATTTTTTTTGTTGT1400.13999999999999999No Hit
CGGTATAGTTTTATAAGAGATAGTTATATTTGGGTTTTTT1380.13799999999999998No Hit
CGGGGTTTAGTAAATATATAAGTGGATGTTTATAGTTAGT1310.131No Hit
CGGGATTTCGCGGAGGGTAGGTTGTACGGGTGATCGTGTG1280.128No Hit
TGGTGATAGTGATAGATAAGGTTTTTGGAGGAAAAAAAAA1260.126No Hit
CGGTATAGTTTTATAAGAGATAGTTATATTAGGGTTTTTT1190.11900000000000001No Hit
CGGGGTTCGAGTTTCGAGTCGAGCGGAAGGGATTTGTGTT1190.11900000000000001No Hit
CGGGTAGTTTGTTTTTTTATGTATCGTAGTTTTAAGTTTT1180.11800000000000001No Hit
CGGGGATTTATTTTATAATTAGTTTTTAAACGTTGATATT1040.104No Hit
CGGTATTGTAGAATAGTGTATATTAATGAGTTATAATGAG1020.10200000000000001No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGAGAT455.822585E-934.0275271
CGGGGGA407.8844096E-834.0275271
CGGGGAA200.002765877434.0275271
CGGATGA200.002765877434.0275271
CGGATAG1500.034.0275271
CGGGTTA1300.034.0275271
CGGGTGG553.274181E-1134.0275271
CGGGTAA301.46209E-534.0275271
CGGAAGA553.274181E-1134.0275271
CGGAAAT407.8844096E-834.0275271
CGGAAAG301.46209E-534.0275271
CGGAAAA252.0053833E-434.0275271
CGGGATA700.034.0275271
CGGTGTT950.034.0275271
CGGTGTG351.0713647E-634.0275271
CGGTGAA200.002765877434.0275271
GGGATTC553.274181E-1134.0275272
CGGTTTC200.002765877434.0275271
CGGTTGA553.274181E-1134.0275271
CGGTTAA200.002765877434.0275271