FastQCFastQC Report
Tue 8 Mar 2016
RNA-Seq.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
FilenameRNA-Seq.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences100000
Sequences flagged as poor quality0
Sequence length40
%GC47

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCT81228.122Illumina Paired End PCR Primer 2 (100% over 40bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGATCGGAAG50865.086Illumina Paired End PCR Primer 2 (97% over 36bp)
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTAC10851.085Illumina Single End PCR Primer 1 (100% over 40bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGGAAG5080.508Illumina Paired End PCR Primer 2 (97% over 36bp)
AATTATACGGCGACCACCGAGATCTACACTCTTTCCCTAC2420.242Illumina Single End PCR Primer 1 (97% over 40bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAAGATCGGAA2350.23500000000000001Illumina Paired End Adapter 2 (96% over 31bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCGAGATCGGAAGA2280.22799999999999998Illumina Paired End Adapter 2 (96% over 28bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGGACG2050.20500000000000002Illumina Paired End PCR Primer 2 (97% over 36bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGGATCGGAA1830.183Illumina Paired End Adapter 2 (100% over 32bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGGTCGGAAG1830.183Illumina Paired End Adapter 2 (100% over 32bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGAACT1640.164Illumina Paired End PCR Primer 2 (97% over 40bp)
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGGTCT1290.129Illumina Paired End PCR Primer 2 (97% over 40bp)
AATTATACTTCTACCACCTATATCTACACTCTTTCCCTAC1230.123No Hit
GATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGGACT1220.122Illumina Paired End PCR Primer 2 (97% over 36bp)
CGGTTCAGCAGGAATGCCGAGATCGGAAGAGCGGTTCAGC1130.11299999999999999Illumina Paired End PCR Primer 2 (96% over 25bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCGAAC351.0615131E-634.06767333
ACCGGAC301.4503141E-534.0676733
ACCGGAA553.092282E-1134.0676733
GACCGGT200.002749916934.0676732
GACCGGA950.034.0676732
CGAGGAT301.4503141E-534.0676729
AGACCGG1150.034.0676731
GCGACCC200.00278390433.98250210
GTGGAAA200.00278390433.98250216
TTATACG200.00278390433.9825023
GGCGACC1600.033.9825029
TCCCTAC1750.033.09430734
CGGCGAC1650.032.952738
TACGGCG1650.032.952736
ATACGGC1650.032.952735
TACACTC1650.032.9527325
TGATACG1450.032.8106883
GCGACCA1450.032.81068810
CCACCGA1450.032.81068814
CCGAGAC11600.032.7460828