FastQCFastQC Report
Tue 8 Mar 2016
454_SRR073599.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename454_SRR073599.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences125000
Sequences flagged as poor quality0
Sequence length44-2042
%GC43

[FAIL]Per base sequence quality

Per base quality graph

[WARN]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTTAGGTAGGCAAATGTAAGACTAAGGTTGGGTCTTGCTGGAGGAGTTTT2560.20479999999999998No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GGTAGGC2657.6141987E-752.314345
GTAGGCA3101.17650125E-437.2669336
TCTAGCC2600.00223460535.546923
GGCAAAT3402.0252842E-433.9786769
TAGGCAA3502.4011417E-433.0078547
CTTAGGT3904.5288328E-429.6224371
TTAGGTA4206.986952E-427.5065482
AGGTAGG4500.001045349625.6727774
TAGGTAG5100.002166704522.652453
AGGCAAA5500.003358551321.0050018
GTCCCCC650.00660803818.70182170-179
GAGACTG12500.017.348333490-494
CTGAGAC12850.015.911477490-494
AGACTGC11750.015.291842490-494
GACTGCC11350.014.738986490-494
ACTGCCA12000.014.456943490-494
ACAGGGA4301.4161963E-414.351954490-494
AGGCACG3059.033403E-414.219944490-494
TGAGACT14400.014.198783490-494
CTGCCAA12050.011.311894490-494